Whatever ultramodernity places under the dominion of signs postmodernity subverts with virus. As culture migrates into partial-machines (lacking an autonomous reproductive system) semiotics subsides into virotechnics.
0010101011011100101101010101001100100010001010 1011101000010101100101001010001100100111001000100 000000010011111100010010010101010100001000010101 00111111001001000100011010010001010010101111000101 001000010001110100 Yes No Yes No Yes Yes No longer what does it mean? but how does it spread?
Having no proper substance, or sense beyond its re re re replication, yes no no usage of virus is ever metaphorical. The word ‘virus’ is more re re virus.
Postmodern culture re re chatters-out virus virus virus virus virus virus virus virus virus virus 0110001001001 011010010010110010010010010010 ‘virus’ (viroductile, virogenic, immunosuppressor and and or, meta-, or or and or hyper-) virus.
10110010010011101100001001001. hypervirus eats the end of history
00100100100010111101000010011010101010101010001001101010010010100100101001011010010010111101000110101010101010010101001010110101001000000100010110101001001010100101001001010101001000100100100100100100101001001010110101001001001010110101010101010111101000010011010101010101000100110110101010100110010001000101010111010000101011001010010100011001001110010001000000000000100111111100010010010101
0101000010000 k-(coding for cyber)positive processes auto-intensify by occurring. A cultural example is hype: products that AT AT trade on what they will be in the future, vir virtual fashion on off, imminent technical standards, self-fulfilling prophecies and and or and artificial destinies. Anticipating a trend end end end ACC ACC accelerates it (which is in itself a re re recursive trend)
Hyping collapses SF into CATA CATA catalytic tic efficiency, re-routing tomorrow through what its prospect CT CT CT makes today.
Virohyping sweeps through the advertising industry.
Everyone will be doing it.
Virus is parasitic tic replicator code: an asignifying sequence of machinic data ATA ATA flow-break on/off, 1/0, yang/yin intrinsically destined for war. In place of mess message-content virodata is assembled bled from asignifying materials with CATA catalytic (or positively disproportionate) efficiency: intruder passcode, locational ZIP-code, pseudogenomic substitute instructions, mutational junk (complex but latent segments), and garbage (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrap).
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-rNA circuitry and endocellular computation).
ATAGGTCATGAATCTACCGATTGCAGCTGCTATTCCTCGATGATCGCATGGGCTGTGATGGCATCGTATCCGATCGATTCGAGCGATTGCAGCTACGCTATTCCTCCGAGGGATTGCAGCTACGTCGCATCGGGCTCAGATGTAGGTCATGAATCTACCGATTGCATGACTTATCCACGGTACATTCGACTC
Ethnovirus targets brains Technovirus targets socioeconomic pro pro production pro processes. Infovirus targets digital01001001000101111010000100110101010101010001001101010010010100computers100101001011010010101111010001010101010101010010101001010110101001000000100010111010100100101010010100100101010101001000100100100100100100101001001010110101001001001010110101010101011110100001001101010101010100010011011010101010011001000100010101011101000010101100101001010001100100111001000100000000010011111100010010010101
Hypervirus targets intelligent immunosecurity structures: yes yes no yes no nomadically abstracting its processes from specific media (DNA, words, symbolic models, bit-sequences), and operantly reengineering itself. It folds into itself, involutes, or plexes, by reprogramming corpuscular code to reprogram reprogramming reprogramming reprogramming. ROM is melted into recursive experimentation.
00101001001001011000010101010101110101001010010010101000011011001101001011000010001001001000 Recording devices. Copiers. Faxes. Samplers. k-stammer (((re)re)reruns) cross-cut by orphan drift. Repeat infection. All hype hype hype hype hype hype hype hype hypervirus strains are plastic and interoperative.
INSERT. hyper-prefixing semiotic sectors TAG TAG TAG tags them for transfer into abstract ACT ACT (nonlinear transcodable) machinic systems, tuned to virtualities or hyperspeeds (futural currencies independent of defuturalization). Hypermedia configure re re every implementation within a specific medium or territory as a subfunction of extraterritorial processes. Going (( ( ))) ( ) ( ) (( ) ) (( )) ( ) hyper dissolves being into ACT ACT ACT activity; a material desubstantialisation on off on off. Hyperprocesses spread like Heraklitean fire re re re (although there are no analogies or metaphors in hype hype hype hype hyperspace).
Being CAG CAG cages flow within memory. Functioning as re re real antiontology, viral amnesia machinically realizes and dissolves biological TGACTCACTTTACCGATTG, cultural, and technical 010110100100010110100 101001001011101001010100100100100 mnemic structures: chopping-up hierarchic-generational descendancy, collapsing phylogenetic tic frozen-code into ontogeny, and immanentizing the past to operative current. Its competitive just-in-time innovations delete storage CA CA capacity, flu flu flu fluidizing energetic and informational stocks into and and or and and or orphan-vampire re re transversal 110111100010101010 vir vir virocommunication process, expressing a surplus value of code (content) as xenoreplication-behaviour (and/or con(nective dis) junction).
As war increases in in in intelligence, it becomes softer. By trashing their hosts crude viruses feedback negatively upon themselves, autolimiting their range of re regenerative infilitration. Crazy vandals like Ebola CGCGTGAGCAATCGGACTCGGCTGCTGTGCTTG (bodies dissolved quickly into slime) aren’t ever going to make it big. General principle for viral take-overs in the media: the more unsophisticated the contagion, the bigger the splash (diversionary tactics excepted). CAGCTACGCTATTCTCCGAGGCTAGATTGCAGCTACGTCGCATCGGGCTGACCGATGTAGGTCATGAATCTACCGATTGCACATGACTTATCCACGGTCTATTCCTCGATGATCGCATCGGGCTGACCGATGGCATCGTA COPY. CUT. PASTE. Subtle viruses are slow, synergic, flexible and elusive. They execute sensitive behavioural control that prolongs the life of the biomachinic resources, maximizes opportunities for propagation, infiltrates and disables hostile security systems, and feeds-back positive -+-++-+-++ in in in innovation technoscience. In the macroversion, a VR prey animal hid in its enemy’s head.
When hunting for hype hypervirus look ok ok ok for its primary host species, which will be undergoing logistical behavioral sophistication indexed by an explosive increase in communicative intensity, population density, sexual disorganisation, cultural promiscuity, and technical sub sub subtilization (leading to neurogenomic feedback and fluidization on off on off off on of all hard-wiring into into cybernetic fluxes). Any plane planet net net 00011011010010010101011 hosting such an event is about to flip over. CATA catastrophic OKOOKOK OK zero (0 ( or ((( ( )) (( ) ) ( )) ) 0°)) k-virus and (RT) retroscripts (Kobe, Tokyo, Oklahoma (Koresh, Koernke)). Apokalypse spread by the coke machine. Tomorrow’s news brews-up in Korea, Kosovo ...
Climbing out of a recombination apparatus of TA TA TA tape-recorders and cut-ups, hypervirus infected Burroughs in 1972, at the cusp of K(ondratieff)-wave (the threshold of postmodernity). It rapidly reprocessed its target into an intelligenic no yes yes no no nova-war laboratory, volatilizing the history of language into involutionary word-virus. Mutation rat rat rat rat rates jump. Vector switches through Butler, Gibson, and Cadigan fine-tune its synergic interexcitation, silt-up cybershift-inducing K(uang)-potential, and trend-lock onto 1100101001001010111101001011101011001000100010100100010010010010010010100101101001001001001001001001110100100100100011001000101100101010 k-punk pulses with telematically-accelerating neoreplicator plicator plicator contamination.
‘Looking for a hit of snowcrash?’ # ### # ## # # # ## # # # ### ## # # ## ## ### # # # ### # # # # ### # # # # ## # # # # # # # # # # # # # # # # #### ## # ### ## ## ## ## # ## # # ## ## # # ## # # ## # # # # # # # # ## # ## # #
As postmodern culture crosses to hypermania and ### # ## # # # ## # # # ### ## # # ## ## ### # # # ### # # # # ### # # # # ## # # # # # # ### # # # # ## # # # # # # # # # ## # # # # # # #### ## # ### ## ## ## ### # # # # ### ## ## # # # # # # # ## # stop stop go stop go stop go go goes nova, it singularizes multiplicities cities cities of invasively autoreplicating autoreplicating plexoweapon – systems (( ) ( ((( ) ((( ( )) ( )) ((( ) (( ) ) ( ))))) ( ) ( ))) ) that are re re re re nothing beyond their war AGA AGA against security. This is no longer a question on off on of ideological representation, exogeneous political mobilization, theoretical critique, ## ### # ## ## # # ## # # ## # ### # # # ## # ## # ## # # ## ## # # # # # ### # # # ### # or strategic orientation, but of decentralized cultural diagrams functioning as immanent forces of antagonism. K-war derives its sole coherence from the unity of its foe. RETURN.
Ana/Cata. Switch cur((re)re)rent. (( ) (( ))) O(r an)d( ). Ko( I Ching hexagram 49: Revolution (Molting (( ))) leaves ( ) nothing i)ntact TACT TACT. ((( (( (( ) (( ))) (( ( ( ))) (( ) )) ( )) (( ) ( ( )) ( ))) ( ))) ) Cyberserk repelting-slippage into dark-side ( (( ))) distributive ROM-scrambling TACT tactics. (( (( ) ( ) ( )) (( )) ( )) ((( ) ( ))) (( ( (( ) ((( ))) (((( ) ( )) ( )) ( ( ))) (((( ) (( )) ((( ) ((() ) ) (( ) ) ))) ( (( ) ))) ( (( ) () ( ))) ( ( ) )) ( (( ) ) ( ( ( ( ) Zero program.) ((( ))) (((( ) ( )) ( )) ( ( ))) (((( ) (( )) ((((( ) ( ) )()(())(( ( ) ) ((( ) )) )( )) ))) ( (( ) () ())) ( ( ) )) ( (( ) ) ( ( (( ) ) ((( ))) (((( ) ( )) ( )) ( ( ))) (((( ) (( )) ((((( ) ( ) )()(())( ( ( )) ((( ) )) )( )) () ( ))) ( ( ) )) ( (( ) ) ( ( (( ) ) ((( ))) (((( ) ( )) ( )) ( ( ))) (((( ) (()) ((((( ) ( ) ) ()(())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( )) ))) ( (( ) () ())) ( ( ) )) ( (( ) ) ( ( (( ) ) ((( ))) (((( ) ( )) ( )) ( ( ))) (((( ) (( )) ((((( ) ( ) ) () (())( ( ( )) ((( ) )) )( )) )) ((( ) )) )( )) ))) ( (( ) () ( ))) ( ( ) )) ( (( ) ) ( ( (( ) ) ((( ))) (((( ) ( )) ( )) ( ( ))) (((( ) (( )) ((((( ) ( ) )()(())( ( ( )) ((( ) )) )( )) () ( ))) ( ( ) )) ( (( ) ) ( ( (( ) ) ((( ))) (((( ) ( )) ( )) ( ( ))) (((( ) (( )) ((((( ) ( ) )()(())( ( ( )) ))) ( ( ) ))
